RNAhub (HOTAIR-D1)

HOTAIR-D1-9459c029 (HOTAIR-D1)

The raw output files for each step of the pipeline can be found here.

Input: sequence:

>HOTAIR_D1:Homo_sapiens/1-526
GACUCGCCUGUGCUCUGGAGCUUGAUCCGAAAGCUUCCACAGUGAGGACUGCUCCGUGGGGGUAAGAGAGCACCAGGCAC
UGAGGCCUGGGAGUUCCACAGACCAACACCCCUGCUCCUGGCGGCUCCCACCCGGGACUUAGACCCUCAGGUCCCUAAUA
UCCCGGAGGUGCUCUCAAUCAGAAAGGUCCUGCUCCGCUUCGCAGUGGAAUGGAACGGAUUUAGAAGCCUGCAGUAGGGG
AGUGGGGAGUGGAGAGAGGGAGCCCAGAGUUACAGACGGCGGCGAGAGGAAGGAGGGGCGUCUUUAUUUUUUUAAGGCCC
CAAAGAGUCUGAUGUUUACAAGACCAGAAAUGCCACGGCCGCGUCCUGGCAGAGAAAAGGCUGAAAUGGAGGACCGGCGC
CUUCCUUAUAAGUAUGCACAUUGGCGAGAGAAGUGCUGCAACCUAAACCAGCAAUUACACCCAAGCUCGUUGGGGCCUAA
GCCAGUACCGACCUGGUAGAAAAAGCAACCACGAAGCUAGAGAGAG

Database: mammal
Mail: mmagnus@fas.harvard.edu

Rfam scan:

No hits were detected to the Rfam database!

R-scape on nhmmer alignment:

The alignment contains 92 sequences with an average pairwise identity of 68.94%.

The secondary structure proposed contains 121 base pairs with 7 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.

BPAIRS 121
avg substitutions per BP  18.8
BPAIRS expected to covary 61.5 +/- 4.9
BPAIRS observed to covary 7

Interactive structure viewer (RFview):

Alignments from each iteration: iteration 1, iteration 2, iteration 3.

List of covarying basepairs (#7)

In given structure	Left Position	Right Position	Score	E-value	p-value	Substitutions	Power
~	590	594	112.76822	1.99687e-05	1.85101e-10	28	0.72
~	590	599	78.30934	0.0371675	3.44526e-07	29	0.73
~	590	595	77.45515	0.0447278	4.14607e-07	28	0.72
~	595	599	88.77965	0.00380322	3.52542e-08	29	0.73
~	598	602	77.50610	0.0442434	4.10117e-07	31	0.75
~	599	603	91.17369	0.00225159	2.08712e-08	29	0.73
~	879	880	97.43062	0.000574416	5.32458e-09	4	0.07

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

Alignment statistics:

None

R-scape on infernal alignment:

The alignment contains 92 sequences with an average pairwise identity of 72.1%.

The secondary structure proposed contains 133 base pairs with 15 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.

BPAIRS 133
avg substitutions per BP  12.2
BPAIRS expected to covary 48.7 +/- 5.1
BPAIRS observed to covary 15

BPAIRS observed to covary possibly coding 17/15 (1.13%)

Interactive structure viewer (RFview):

The Infernal alignment can be found here.

List of covarying basepairs (#15)

In given structure	Left Position	Right Position	Score	E-value	p-value	Substitutions	Power
~	407	411	100.40661	0.000656608	6.08647e-09	10	0.32
~	407	413	87.74746	0.00974762	9.03561e-08	12	0.39
~	407	409	87.74288	0.00974762	9.03561e-08	11	0.35
~	407	408	80.78618	0.0424372	3.93374e-07	10	0.32
*	408	412	97.43460	0.00124294	1.15215e-08	8	0.24
	408	409	85.44818	0.0158685	1.47094e-07	9	0.28
	408	411	81.99748	0.03293	3.05247e-07	8	0.24
	408	413	81.10106	0.0394117	3.65329e-07	10	0.32
~	409	411	87.82040	0.00954317	8.84609e-08	9	0.28
~	409	412	83.06373	0.0260951	2.4189e-07	9	0.28
~	411	413	88.98110	0.0074782	6.93197e-08	10	0.32
~	411	412	81.17952	0.0389975	3.61489e-07	8	0.24
	416	417	84.14277	0.0208962	1.93698e-07	14	0.45
~	421	430	82.70121	0.0281003	2.60478e-07	17	0.52
*	647	648	89.37004	0.00686995	6.36814e-08	6	0.16

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure