RNAhub (HOTAIR-D1)

HOTAIR-D1-9459c029 (HOTAIR-D1)

The raw output files for each step of the pipeline can be found here.

Input: sequence:

>HOTAIR_D1:Homo_sapiens/1-526
GACUCGCCUGUGCUCUGGAGCUUGAUCCGAAAGCUUCCACAGUGAGGACUGCUCCGUGGGGGUAAGAGAGCACCAGGCAC
UGAGGCCUGGGAGUUCCACAGACCAACACCCCUGCUCCUGGCGGCUCCCACCCGGGACUUAGACCCUCAGGUCCCUAAUA
UCCCGGAGGUGCUCUCAAUCAGAAAGGUCCUGCUCCGCUUCGCAGUGGAAUGGAACGGAUUUAGAAGCCUGCAGUAGGGG
AGUGGGGAGUGGAGAGAGGGAGCCCAGAGUUACAGACGGCGGCGAGAGGAAGGAGGGGCGUCUUUAUUUUUUUAAGGCCC
CAAAGAGUCUGAUGUUUACAAGACCAGAAAUGCCACGGCCGCGUCCUGGCAGAGAAAAGGCUGAAAUGGAGGACCGGCGC
CUUCCUUAUAAGUAUGCACAUUGGCGAGAGAAGUGCUGCAACCUAAACCAGCAAUUACACCCAAGCUCGUUGGGGCCUAA
GCCAGUACCGACCUGGUAGAAAAAGCAACCACGAAGCUAGAGAGAG

Database: mammal

Rfam scan:

No hits were detected to the Rfam database!

R-scape on nhmmer alignment:

The secondary structure proposed contains 121 base pairs with 7 base pairs observed to covary.

BPAIRS 121
avg substitutions per BP  18.8
BPAIRS expected to covary 61.5 +/- 4.9
BPAIRS observed to covary 7

The final nhmmer alignment can be found here.

Alignments from each iteration: iteration 1, iteration 2, iteration 3.

List of covarying basepairs (#7)

In given structure	Left Position	Right Position	Score	E-value	p-value	Substitutions	Power
~	590	594	112.76822	1.99687e-05	1.85101e-10	28	0.72
~	590	599	78.30934	0.0371675	3.44526e-07	29	0.73
~	590	595	77.45515	0.0447278	4.14607e-07	28	0.72
~	595	599	88.77965	0.00380322	3.52542e-08	29	0.73
~	598	602	77.50610	0.0442434	4.10117e-07	31	0.75
~	599	603	91.17369	0.00225159	2.08712e-08	29	0.73
~	879	880	97.43062	0.000574416	5.32458e-09	4	0.07

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

Alignment statistics:

Alignment number:    1
Alignment name:      HOTAIR_D1:Homo_sapiens/1-526
Format:              Stockholm
Number of sequences: 92
Alignment length:    936
Total # residues:    36040
Smallest:            132
Largest:             502
Average length:      391.7
Average identity:    66%

R-scape on infernal alignment:

The secondary structure proposed contains 0 base pairs with 15 base pairs observed to covary.

BPAIRS expected to covary 48.7 +/- 5.1
BPAIRS observed to covary 15

BPAIRS observed to covary possibly coding 17/15 (1.13%)

The Infernal alignment can be found here.

List of covarying basepairs (#15)

In given structure	Left Position	Right Position	Score	E-value	p-value	Substitutions	Power
~	407	411	100.40661	0.000656608	6.08647e-09	10	0.32
~	407	413	87.74746	0.00974762	9.03561e-08	12	0.39
~	407	409	87.74288	0.00974762	9.03561e-08	11	0.35
~	407	408	80.78618	0.0424372	3.93374e-07	10	0.32
*	408	412	97.43460	0.00124294	1.15215e-08	8	0.24
	408	409	85.44818	0.0158685	1.47094e-07	9	0.28
	408	411	81.99748	0.03293	3.05247e-07	8	0.24
	408	413	81.10106	0.0394117	3.65329e-07	10	0.32
~	409	411	87.82040	0.00954317	8.84609e-08	9	0.28
~	409	412	83.06373	0.0260951	2.4189e-07	9	0.28
~	411	413	88.98110	0.0074782	6.93197e-08	10	0.32
~	411	412	81.17952	0.0389975	3.61489e-07	8	0.24
	416	417	84.14277	0.0208962	1.93698e-07	14	0.45
~	421	430	82.70121	0.0281003	2.60478e-07	17	0.52
*	647	648	89.37004	0.00686995	6.36814e-08	6	0.16

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

Job log: