The raw output files for each step of the pipeline can be found here.
Input: sequence:
>HOTAIR_D1:Homo_sapiens/1-526 GACUCGCCUGUGCUCUGGAGCUUGAUCCGAAAGCUUCCACAGUGAGGACUGCUCCGUGGGGGUAAGAGAGCACCAGGCAC UGAGGCCUGGGAGUUCCACAGACCAACACCCCUGCUCCUGGCGGCUCCCACCCGGGACUUAGACCCUCAGGUCCCUAAUA UCCCGGAGGUGCUCUCAAUCAGAAAGGUCCUGCUCCGCUUCGCAGUGGAAUGGAACGGAUUUAGAAGCCUGCAGUAGGGG AGUGGGGAGUGGAGAGAGGGAGCCCAGAGUUACAGACGGCGGCGAGAGGAAGGAGGGGCGUCUUUAUUUUUUUAAGGCCC CAAAGAGUCUGAUGUUUACAAGACCAGAAAUGCCACGGCCGCGUCCUGGCAGAGAAAAGGCUGAAAUGGAGGACCGGCGC CUUCCUUAUAAGUAUGCACAUUGGCGAGAGAAGUGCUGCAACCUAAACCAGCAAUUACACCCAAGCUCGUUGGGGCCUAA GCCAGUACCGACCUGGUAGAAAAAGCAACCACGAAGCUAGAGAGAGDatabase: mammal
No hits were detected to the Rfam database!
The secondary structure proposed contains 121 base pairs with 7 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.
BPAIRS 121 avg substitutions per BP 18.8 BPAIRS expected to covary 61.5 +/- 4.9 BPAIRS observed to covary 7
The final nhmmer alignment can be found here.
Alignments from each iteration: iteration 1, iteration 2, iteration 3.
| In given structure | Left Position | Right Position | Score | E-value | p-value | Substitutions | Power |
|---|---|---|---|---|---|---|---|
| ~ | 590 | 594 | 112.76822 | 1.99687e-05 | 1.85101e-10 | 28 | 0.72 |
| ~ | 590 | 599 | 78.30934 | 0.0371675 | 3.44526e-07 | 29 | 0.73 |
| ~ | 590 | 595 | 77.45515 | 0.0447278 | 4.14607e-07 | 28 | 0.72 |
| ~ | 595 | 599 | 88.77965 | 0.00380322 | 3.52542e-08 | 29 | 0.73 |
| ~ | 598 | 602 | 77.50610 | 0.0442434 | 4.10117e-07 | 31 | 0.75 |
| ~ | 599 | 603 | 91.17369 | 0.00225159 | 2.08712e-08 | 29 | 0.73 |
| ~ | 879 | 880 | 97.43062 | 0.000574416 | 5.32458e-09 | 4 | 0.07 |
* Base pair in the structure ~ Both residues unpaired in the structure, or no structure is present ' ' At least one residue is involved in other pairing in the structure
None
The secondary structure proposed contains 0 base pairs with 15 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.
BPAIRS expected to covary 48.7 +/- 5.1 BPAIRS observed to covary 15 BPAIRS observed to covary possibly coding 17/15 (1.13%)
The Infernal alignment can be found here.
| In given structure | Left Position | Right Position | Score | E-value | p-value | Substitutions | Power |
|---|---|---|---|---|---|---|---|
| ~ | 407 | 411 | 100.40661 | 0.000656608 | 6.08647e-09 | 10 | 0.32 |
| ~ | 407 | 413 | 87.74746 | 0.00974762 | 9.03561e-08 | 12 | 0.39 |
| ~ | 407 | 409 | 87.74288 | 0.00974762 | 9.03561e-08 | 11 | 0.35 |
| ~ | 407 | 408 | 80.78618 | 0.0424372 | 3.93374e-07 | 10 | 0.32 |
| * | 408 | 412 | 97.43460 | 0.00124294 | 1.15215e-08 | 8 | 0.24 |
| 408 | 409 | 85.44818 | 0.0158685 | 1.47094e-07 | 9 | 0.28 | |
| 408 | 411 | 81.99748 | 0.03293 | 3.05247e-07 | 8 | 0.24 | |
| 408 | 413 | 81.10106 | 0.0394117 | 3.65329e-07 | 10 | 0.32 | |
| ~ | 409 | 411 | 87.82040 | 0.00954317 | 8.84609e-08 | 9 | 0.28 |
| ~ | 409 | 412 | 83.06373 | 0.0260951 | 2.4189e-07 | 9 | 0.28 |
| ~ | 411 | 413 | 88.98110 | 0.0074782 | 6.93197e-08 | 10 | 0.32 |
| ~ | 411 | 412 | 81.17952 | 0.0389975 | 3.61489e-07 | 8 | 0.24 |
| 416 | 417 | 84.14277 | 0.0208962 | 1.93698e-07 | 14 | 0.45 | |
| ~ | 421 | 430 | 82.70121 | 0.0281003 | 2.60478e-07 | 17 | 0.52 |
| * | 647 | 648 | 89.37004 | 0.00686995 | 6.36814e-08 | 6 | 0.16 |
* Base pair in the structure ~ Both residues unpaired in the structure, or no structure is present ' ' At least one residue is involved in other pairing in the structure