RNAhub


RNAhub (HOTAIR-D1)

HOTAIR-D1-9459c029 (HOTAIR-D1)

The raw output files for each step of the pipeline can be found here.

Input: sequence:

>HOTAIR_D1:Homo_sapiens/1-526
GACUCGCCUGUGCUCUGGAGCUUGAUCCGAAAGCUUCCACAGUGAGGACUGCUCCGUGGGGGUAAGAGAGCACCAGGCAC
UGAGGCCUGGGAGUUCCACAGACCAACACCCCUGCUCCUGGCGGCUCCCACCCGGGACUUAGACCCUCAGGUCCCUAAUA
UCCCGGAGGUGCUCUCAAUCAGAAAGGUCCUGCUCCGCUUCGCAGUGGAAUGGAACGGAUUUAGAAGCCUGCAGUAGGGG
AGUGGGGAGUGGAGAGAGGGAGCCCAGAGUUACAGACGGCGGCGAGAGGAAGGAGGGGCGUCUUUAUUUUUUUAAGGCCC
CAAAGAGUCUGAUGUUUACAAGACCAGAAAUGCCACGGCCGCGUCCUGGCAGAGAAAAGGCUGAAAUGGAGGACCGGCGC
CUUCCUUAUAAGUAUGCACAUUGGCGAGAGAAGUGCUGCAACCUAAACCAGCAAUUACACCCAAGCUCGUUGGGGCCUAA
GCCAGUACCGACCUGGUAGAAAAAGCAACCACGAAGCUAGAGAGAG

Database: mammal

Rfam scan:

No hits were detected to the Rfam database!

R-scape on nhmmer alignment:

The secondary structure proposed contains 121 base pairs with 7 base pairs observed to covary.

BPAIRS 121
avg substitutions per BP  18.8
BPAIRS expected to covary 61.5 +/- 4.9
BPAIRS observed to covary 7

The final nhmmer alignment can be found here.

Alignments from each iteration: iteration 1, iteration 2, iteration 3.

List of covarying basepairs (#7)
In given structure Left Position Right Position Score E-value p-value Substitutions Power
~ 590 594 112.76822 1.99687e-05 1.85101e-10 28 0.72
~ 590 599 78.30934 0.0371675 3.44526e-07 29 0.73
~ 590 595 77.45515 0.0447278 4.14607e-07 28 0.72
~ 595 599 88.77965 0.00380322 3.52542e-08 29 0.73
~ 598 602 77.50610 0.0442434 4.10117e-07 31 0.75
~ 599 603 91.17369 0.00225159 2.08712e-08 29 0.73
~ 879 880 97.43062 0.000574416 5.32458e-09 4 0.07
* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure
Alignment statistics:
None

R-scape on infernal alignment:

The secondary structure proposed contains 0 base pairs with 15 base pairs observed to covary.

BPAIRS expected to covary 48.7 +/- 5.1
BPAIRS observed to covary 15

BPAIRS observed to covary possibly coding 17/15 (1.13%)

The Infernal alignment can be found here.

List of covarying basepairs (#15)
In given structure Left Position Right Position Score E-value p-value Substitutions Power
~ 407 411 100.40661 0.000656608 6.08647e-09 10 0.32
~ 407 413 87.74746 0.00974762 9.03561e-08 12 0.39
~ 407 409 87.74288 0.00974762 9.03561e-08 11 0.35
~ 407 408 80.78618 0.0424372 3.93374e-07 10 0.32
* 408 412 97.43460 0.00124294 1.15215e-08 8 0.24
408 409 85.44818 0.0158685 1.47094e-07 9 0.28
408 411 81.99748 0.03293 3.05247e-07 8 0.24
408 413 81.10106 0.0394117 3.65329e-07 10 0.32
~ 409 411 87.82040 0.00954317 8.84609e-08 9 0.28
~ 409 412 83.06373 0.0260951 2.4189e-07 9 0.28
~ 411 413 88.98110 0.0074782 6.93197e-08 10 0.32
~ 411 412 81.17952 0.0389975 3.61489e-07 8 0.24
416 417 84.14277 0.0208962 1.93698e-07 14 0.45
~ 421 430 82.70121 0.0281003 2.60478e-07 17 0.52
* 647 648 89.37004 0.00686995 6.36814e-08 6 0.16
* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

Job log: