The raw output files for each step of the pipeline can be found here.
Input: sequence:
>u6 human GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACG CAAAUUCGUGAAGCGUUCCAUAUUUUUDatabase: metazoa
rank E-value score bias modelname start end mdl trunc gc description (1) ! 6.3e-29 109.4 0.0 U6 1 107 + cm no 0.46 U6 spliceosomal RNA Rfam accession for U6: RF00026 saved to /home/rnahub/rnahub-web/media/jobs//U6-0c44b443/seq+RF00026_seed.fa >u6 human GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACG CAAAUUCGUGAAGCGUUCCAUAUUUUU >AB010698.1/46416-46518 GUCCCUUCGGGGACAUCUGAUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUG CGCAAGGAUGACACGCAUAAAUCGAGAAAUGGUCCAAAUUUUU >AARH01001853.1/272694-272592 GUCUCUUCGGAGACAUCUGAUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUG CGCAAGGAUGACACGCACAAAUCGAGAAAUGGUCCAAAUUUUU >X60506.1/390-492 GUCCCUUCGGGGACAUCCGAUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUG CGCAAGGAUGACACGCACAAAUCGAGAAAUGGUCCAAAUUUUU >AC146705.11/15272-15374 GUCCCUUCGGGGACAUCCGAUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUG CGCAAGGAUGACACGCACAAAUCGAGAAAUGGUCCAAAUUUUU [...] cmalign RF00026.cm /home/rnahub/rnahub-web/media/jobs//U6-0c44b443/seq+RF00026_seed.fa > /home/rnahub/rnahub-web/media/jobs//U6-0c44b443/seq+RF00026_seed.sto /home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//U6-0c44b443/seq+RF00026_seed.sto > /home/rnahub/rnahub-web/media/jobs//U6-0c44b443/rfam_stats.txt cmd: /home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//U6-0c44b443/seq+RF00026_seed.sto > /home/rnahub/rnahub-web/media/jobs//U6-0c44b443/rfam_stats.txt Rscape DONE Query u6 length 107 in the alignment seq+RF00026_seed.sto number of columns with low coverage (<50%) for the query sequence 1; coverge for the query: 99%
The alignment contains 189 sequences with an average pairwise identity of 70.9%.
The secondary structure proposed contains 19 base pairs with 3 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.
The final alignment (*R2R.sto) can be found here.
BPAIRS 19 avg substitutions per BP 23.2 BPAIRS expected to covary 10.1 +/- 1.9 BPAIRS observed to covary 3
| In given structure | Left Position | Right Position | Score | E-value | p-value | Substitutions | Power |
|---|---|---|---|---|---|---|---|
| * | 2 | 50 | 272.77949 | 4.86652e-07 | 8.42249e-11 | 49 | 0.86 |
| * | 3 | 49 | 258.80373 | 1.66548e-06 | 2.88245e-10 | 59 | 0.89 |
| * | 5 | 45 | 214.78797 | 8.08633e-05 | 1.3995e-08 | 56 | 0.88 |
* Base pair in the structure ~ Both residues unpaired in the structure, or no structure is present ' ' At least one residue is involved in other pairing in the structure
Alignment number: 1 Format: Stockholm Number of sequences: 189 Alignment length: 225 Total # residues: 20223 Smallest: 85 Largest: 167 Average length: 107.0 Average identity: 70%
The alignment contains 178 sequences with an average pairwise identity of 94.36%.
The secondary structure proposed contains 26 base pairs with 0 base pairs observed to covary, indicating no covariation support for any secondary structure in the alignment.
avg substitutions per BP 5.7 BPAIRS expected to covary 3.8 +/- 1.4 BPAIRS observed to covary 0
Alignments from each iteration: iteration 1, iteration 2, iteration 3.
None