The raw output files for each step of the pipeline can be found here.
Input: sequence:
>xrRNA GGGAGTATAAAGAACACTAGCCGAGCAAACGAAAGTTGCAAGCATCGGAAGTCAAGTCTTTCACATCAGCCGGACACACA AAATAGATTTCAAATTTCTAGCAGGATTTGCATCAGGCTTTCTTGCCGCAATCCCAATTTCAGTAGCCGGTATTTACTTA GTCTACCTCAAAATCTCACCCACGTGCGGAGCATCGTTADatabase: viral
rank E-value score bias modelname start end mdl trunc gc description (1) ! 7e-09 51.8 0.0 PLRV_xrRNA 11 66 + cm no 0.45 Potato leading responsible virus exoribonuclease-resistant R Rfam accession for PLRV_xrRNA: RF04222 saved to /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.fa >xrRNA GGGAGTATAAAGAACACTAGCCGAGCAAACGAAAGTTGCAAGCATCGGAAGTCAAGTCTTTCACATCAGCCGGACACACA AAATAGATTTCAAATTTCTAGCAGGATTTGCATCAGGCTTTCTTGCCGCAATCCCAATTTCAGTAGCCGGTATTTACTTA GTCTACCTCAAAATCTCACCCACGTGCGGAGCATCGTTA >NC_001726.1/2661-2711 GUCACGUAGCUAGUACCAGGUUGCAAUACUAGAGCGUUAGUCCUGGGGCGU >NC_035451.1/3370-3423 GUAACGUCAGCCGCCAACACAGUUGCAAGAGCGGAAGACGUAGUCUGUGUCAAA >NC_000874.1/3464-3517 GCAUCCCGAGCCACCAUAUAGGUUGCAAGAGUGGAACGGGAAGUCCUAUAGAUA >NC_025837.1/3484-3536 UUUGAACCAGCGAACAAUUCAGUUGCGAGAUUCGAGGUUUCAGUCUGAAUCAU [...] cmalign RF04222.cm /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.fa > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto /home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/rfam_stats.txt cmd: /home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/rfam_stats.txt Rscape DONE Query xrRNA length 199 in the alignment seq+RF04222_seed.sto number of columns with low coverage (<50%) for the query sequence 154; coverge for the query: 23%
The alignment contains 45 sequences with an average pairwise identity of 57.15%.
The secondary structure proposed contains 18 base pairs with 8 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.
The final alignment (*R2R.sto) can be found here.
BPAIRS 18 avg substitutions per BP 17.7 BPAIRS expected to covary 8.7 +/- 1.8 BPAIRS observed to covary 8
| In given structure | Left Position | Right Position | Score | E-value | p-value | Substitutions | Power |
|---|---|---|---|---|---|---|---|
| * | 23 | 61 | 82.24546 | 3.19586e-07 | 1.93337e-10 | 20 | 0.59 |
| * | 24 | 60 | 82.58563 | 2.91328e-07 | 1.76242e-10 | 27 | 0.70 |
| * | 25 | 58 | 89.03802 | 5.29296e-08 | 3.20203e-11 | 26 | 0.69 |
| * | 26 | 57 | 55.71832 | 0.000358887 | 2.17112e-07 | 13 | 0.42 |
| ~ | 46 | 222 | 51.59297 | 0.00108268 | 6.5498e-07 | 23 | 0.64 |
| ~ | 47 | 221 | 90.56741 | 3.51373e-08 | 2.12567e-11 | 22 | 0.63 |
| ~ | 48 | 220 | 91.33131 | 2.88191e-08 | 1.74344e-11 | 18 | 0.55 |
| ~ | 49 | 219 | 61.23492 | 8.32684e-05 | 5.03741e-08 | 4 | 0.07 |
* Base pair in the structure ~ Both residues unpaired in the structure, or no structure is present ' ' At least one residue is involved in other pairing in the structure
Alignment number: 1 Format: Stockholm Number of sequences: 45 Alignment length: 228 Total # residues: 2683 Smallest: 51 Largest: 199 Average length: 59.6 Average identity: 56%
The alignment contains 71 sequences with an average pairwise identity of 60.9%.
The secondary structure proposed contains 21 base pairs with 5 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.
BPAIRS 21 avg substitutions per BP 17.9 BPAIRS expected to covary 9.7 +/- 1.8 BPAIRS observed to covary 5
Alignments from each iteration: iteration 1, iteration 2, iteration 3.
| In given structure | Left Position | Right Position | Score | E-value | p-value | Substitutions | Power |
|---|---|---|---|---|---|---|---|
| ~ | 2 | 36 | 60.09942 | 0.0174266 | 1.10624e-06 | 38 | 0.82 |
| ~ | 8 | 31 | 64.14652 | 0.00675761 | 4.28973e-07 | 32 | 0.78 |
| ~ | 10 | 28 | 85.65505 | 4.34171e-05 | 2.75611e-09 | 30 | 0.76 |
| ~ | 18 | 53 | 114.10068 | 5.49344e-08 | 3.48723e-12 | 23 | 0.68 |
| ~ | 19 | 52 | 84.08388 | 6.31734e-05 | 4.01025e-09 | 10 | 0.36 |
* Base pair in the structure ~ Both residues unpaired in the structure, or no structure is present ' ' At least one residue is involved in other pairing in the structure
Alignment number: 1 Alignment name: xrRNA Format: Stockholm Number of sequences: 71 Alignment length: 201 Total # residues: 11859 Smallest: 94 Largest: 184 Average length: 167.0 Average identity: 60%
The alignment contains 71 sequences with an average pairwise identity of 60.65%.
The secondary structure proposed contains 18 base pairs with 4 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.
BPAIRS 18 avg substitutions per BP 15.6 BPAIRS expected to covary 7.5 +/- 1.6 BPAIRS observed to covary 4
The Infernal alignment can be found here.
| In given structure | Left Position | Right Position | Score | E-value | p-value | Substitutions | Power |
|---|---|---|---|---|---|---|---|
| ~ | 9 | 32 | 71.80894 | 0.000194742 | 1.23622e-08 | 31 | 0.77 |
| ~ | 11 | 29 | 84.13270 | 5.04413e-06 | 3.20201e-10 | 30 | 0.76 |
| * | 19 | 54 | 118.96332 | 1.4461e-10 | 9.17981e-15 | 23 | 0.68 |
| * | 20 | 53 | 84.74503 | 4.2177e-06 | 2.67739e-10 | 10 | 0.36 |
* Base pair in the structure ~ Both residues unpaired in the structure, or no structure is present ' ' At least one residue is involved in other pairing in the structure