RNAhub (xrRNA)

xrRNA-2bea680d (xrRNA)

The raw output files for each step of the pipeline can be found here.

Input: sequence:

>xrRNA
GGGAGTATAAAGAACACTAGCCGAGCAAACGAAAGTTGCAAGCATCGGAAGTCAAGTCTTTCACATCAGCCGGACACACA
AAATAGATTTCAAATTTCTAGCAGGATTTGCATCAGGCTTTCTTGCCGCAATCCCAATTTCAGTAGCCGGTATTTACTTA
GTCTACCTCAAAATCTCACCCACGTGCGGAGCATCGTTA

Database: viral

PDB hits:

No hits were detected to the PDB database!

Rfam hits:

 rank     E-value  score  bias  modelname          start    end   mdl trunc   gc  description
  (1) !     7e-09   51.8   0.0  PLRV_xrRNA            11     66 +  cm    no 0.45  Potato leading responsible virus exoribonuclease-resistant R

Rfam accession for PLRV_xrRNA: RF04222
saved to /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.fa
>xrRNA
GGGAGTATAAAGAACACTAGCCGAGCAAACGAAAGTTGCAAGCATCGGAAGTCAAGTCTTTCACATCAGCCGGACACACA
AAATAGATTTCAAATTTCTAGCAGGATTTGCATCAGGCTTTCTTGCCGCAATCCCAATTTCAGTAGCCGGTATTTACTTA
GTCTACCTCAAAATCTCACCCACGTGCGGAGCATCGTTA
>NC_001726.1/2661-2711
GUCACGUAGCUAGUACCAGGUUGCAAUACUAGAGCGUUAGUCCUGGGGCGU
>NC_035451.1/3370-3423
GUAACGUCAGCCGCCAACACAGUUGCAAGAGCGGAAGACGUAGUCUGUGUCAAA
>NC_000874.1/3464-3517
GCAUCCCGAGCCACCAUAUAGGUUGCAAGAGUGGAACGGGAAGUCCUAUAGAUA
>NC_025837.1/3484-3536
UUUGAACCAGCGAACAAUUCAGUUGCGAGAUUCGAGGUUUCAGUCUGAAUCAU
[...]
cmalign RF04222.cm /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.fa > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto
/home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/rfam_stats.txt
cmd: /home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/rfam_stats.txt
Rscape DONE

Query xrRNA length 199 in the alignment seq+RF04222_seed.sto number of columns with low coverage (<50%) for the query sequence 154; coverge for the query: 23%

R-scape on rfam alignment:

The final alignment (*cacofold.sto) can be found here.

List of covarying basepairs (#8)

In given structure	Left Position	Right Position	Score	E-value	p-value	Substitutions	Power
*	23	61	82.24546	3.19586e-07	1.93337e-10	20	0.59
*	24	60	82.58563	2.91328e-07	1.76242e-10	27	0.70
*	25	58	89.03802	5.29296e-08	3.20203e-11	26	0.69
*	26	57	55.71832	0.000358887	2.17112e-07	13	0.42
~	46	222	51.59297	0.00108268	6.5498e-07	23	0.64
~	47	221	90.56741	3.51373e-08	2.12567e-11	22	0.63
~	48	220	91.33131	2.88191e-08	1.74344e-11	18	0.55
~	49	219	61.23492	8.32684e-05	5.03741e-08	4	0.07

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

BPAIRS 18
avg substitutions per BP  17.7
BPAIRS expected to covary 8.7 +/- 1.8
BPAIRS observed to covary 8

Alignment statistics:

Alignment number:    1
Format:              Stockholm
Number of sequences: 45
Alignment length:    228
Total # residues:    2683
Smallest:            51
Largest:             199
Average length:      59.6
Average identity:    56%

R-scape on nhmmer alignment:

The final nhmmer alignment can be found here.

Alignments from each iteration: iteration 1, iteration 2, iteration 3.

List of covarying basepairs (#5)

In given structure	Left Position	Right Position	Score	E-value	p-value	Substitutions	Power
~	2	36	60.09207	0.00812196	5.15582e-07	37	0.80
~	8	31	64.16854	0.00245733	1.55991e-07	34	0.78
~	10	28	85.74422	4.38955e-06	2.78649e-10	31	0.75
~	18	53	114.05572	1.00902e-09	6.40524e-14	25	0.67
~	19	52	84.08620	7.13804e-06	4.53123e-10	10	0.32

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

BPAIRS 22
avg substitutions per BP  19.1
BPAIRS expected to covary 10.1 +/- 1.8
BPAIRS observed to covary 5

Alignment statistics:

Alignment number:    1
Alignment name:      xrRNA
Format:              Stockholm
Number of sequences: 71
Alignment length:    203
Total # residues:    11865
Smallest:            93
Largest:             184
Average length:      167.1
Average identity:    60%

R-scape on infernal alignment:

The Infernal alignment can be found here.

List of covarying basepairs (#4)

In given structure	Left Position	Right Position	Score	E-value	p-value	Substitutions	Power
~	9	32	69.86395	0.00103744	6.58569e-08	31	0.75
~	11	29	87.26142	1.09487e-05	6.95024e-10	29	0.73
*	19	54	118.87457	2.72558e-09	1.7302e-13	19	0.57
*	20	53	84.80969	2.08044e-05	1.32066e-09	12	0.39

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

BPAIRS 37
avg substitutions per BP  21.1
BPAIRS expected to covary 20.4 +/- 2.7
BPAIRS observed to covary 4

Job log: