RNAhub


RNAhub (xrRNA)

xrRNA-2bea680d (xrRNA)

The raw output files for each step of the pipeline can be found here.

Input: sequence:

>xrRNA
GGGAGTATAAAGAACACTAGCCGAGCAAACGAAAGTTGCAAGCATCGGAAGTCAAGTCTTTCACATCAGCCGGACACACA
AAATAGATTTCAAATTTCTAGCAGGATTTGCATCAGGCTTTCTTGCCGCAATCCCAATTTCAGTAGCCGGTATTTACTTA
GTCTACCTCAAAATCTCACCCACGTGCGGAGCATCGTTA

Database: viral
Mail:

Rfam scan:

 rank     E-value  score  bias  modelname          start    end   mdl trunc   gc  description
  (1) !     7e-09   51.8   0.0  PLRV_xrRNA            11     66 +  cm    no 0.45  Potato leading responsible virus exoribonuclease-resistant R

Rfam accession for PLRV_xrRNA: RF04222
saved to /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.fa
>xrRNA
GGGAGTATAAAGAACACTAGCCGAGCAAACGAAAGTTGCAAGCATCGGAAGTCAAGTCTTTCACATCAGCCGGACACACA
AAATAGATTTCAAATTTCTAGCAGGATTTGCATCAGGCTTTCTTGCCGCAATCCCAATTTCAGTAGCCGGTATTTACTTA
GTCTACCTCAAAATCTCACCCACGTGCGGAGCATCGTTA
>NC_001726.1/2661-2711
GUCACGUAGCUAGUACCAGGUUGCAAUACUAGAGCGUUAGUCCUGGGGCGU
>NC_035451.1/3370-3423
GUAACGUCAGCCGCCAACACAGUUGCAAGAGCGGAAGACGUAGUCUGUGUCAAA
>NC_000874.1/3464-3517
GCAUCCCGAGCCACCAUAUAGGUUGCAAGAGUGGAACGGGAAGUCCUAUAGAUA
>NC_025837.1/3484-3536
UUUGAACCAGCGAACAAUUCAGUUGCGAGAUUCGAGGUUUCAGUCUGAAUCAU
[...]
cmalign RF04222.cm /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.fa > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto
/home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/rfam_stats.txt
cmd: /home/rnahub/opt/hmmer/hmmer-3.3.2/bin//esl-alistat /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/seq+RF04222_seed.sto > /home/rnahub/rnahub-web/media/jobs//xrRNA-2bea680d/rfam_stats.txt
Rscape DONE

Query xrRNA length 199 in the alignment seq+RF04222_seed.sto number of columns with low coverage (<50%) for the query sequence 154; coverge for the query: 23%

R-scape on Rfam alignment:

The secondary structure proposed contains 18 base pairs with 8 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.

The final alignment (*cacofold.sto) can be found here.

BPAIRS 18
avg substitutions per BP  17.7
BPAIRS expected to covary 8.7 +/- 1.8
BPAIRS observed to covary 8
List of covarying basepairs (#8)
In given structure Left Position Right Position Score E-value p-value Substitutions Power
* 23 61 82.24546 3.19586e-07 1.93337e-10 20 0.59
* 24 60 82.58563 2.91328e-07 1.76242e-10 27 0.70
* 25 58 89.03802 5.29296e-08 3.20203e-11 26 0.69
* 26 57 55.71832 0.000358887 2.17112e-07 13 0.42
~ 46 222 51.59297 0.00108268 6.5498e-07 23 0.64
~ 47 221 90.56741 3.51373e-08 2.12567e-11 22 0.63
~ 48 220 91.33131 2.88191e-08 1.74344e-11 18 0.55
~ 49 219 61.23492 8.32684e-05 5.03741e-08 4 0.07

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

Alignment statistics:
Alignment number:    1
Format:              Stockholm
Number of sequences: 45
Alignment length:    228
Total # residues:    2683
Smallest:            51
Largest:             199
Average length:      59.6
Average identity:    56%

R-scape on nhmmer alignment:

The secondary structure proposed contains 21 base pairs with 5 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.

BPAIRS 21
avg substitutions per BP  17.9
BPAIRS expected to covary 9.7 +/- 1.8
BPAIRS observed to covary 5

The final nhmmer alignment can be found here.

Alignments from each iteration: iteration 1, iteration 2, iteration 3.

List of covarying basepairs (#5)
In given structure Left Position Right Position Score E-value p-value Substitutions Power
~ 2 36 60.09942 0.0174266 1.10624e-06 38 0.82
~ 8 31 64.14652 0.00675761 4.28973e-07 32 0.78
~ 10 28 85.65505 4.34171e-05 2.75611e-09 30 0.76
~ 18 53 114.10068 5.49344e-08 3.48723e-12 23 0.68
~ 19 52 84.08388 6.31734e-05 4.01025e-09 10 0.36

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure

Alignment statistics:
Alignment number:    1
Alignment name:      xrRNA
Format:              Stockholm
Number of sequences: 71
Alignment length:    201
Total # residues:    11859
Smallest:            94
Largest:             184
Average length:      167.0
Average identity:    60%

R-scape on infernal alignment:

The secondary structure proposed contains 18 base pairs with 4 base pairs observed to covary, indicating covariation support for some of the bases in the proposed structure.

BPAIRS 18
avg substitutions per BP  15.6
BPAIRS expected to covary 7.5 +/- 1.6
BPAIRS observed to covary 4

The Infernal alignment can be found here.

List of covarying basepairs (#4)
In given structure Left Position Right Position Score E-value p-value Substitutions Power
~ 9 32 71.80894 0.000194742 1.23622e-08 31 0.77
~ 11 29 84.13270 5.04413e-06 3.20201e-10 30 0.76
* 19 54 118.96332 1.4461e-10 9.17981e-15 23 0.68
* 20 53 84.74503 4.2177e-06 2.67739e-10 10 0.36

* Base pair in the structure
~ Both residues unpaired in the structure, or no structure is present
' ' At least one residue is involved in other pairing in the structure